Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2485285
End position: 2485308
Length: 24

DNA sequence
>NC_012669, from 2485285 to 2485308 (24 bp); Beutenbergia cavernae DSM 12333 CCGCCGCCGTCGCCACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2484100-2485380	Sequence	Bcav_2207 - extracellular ligand-binding receptor (Protein is coded in complementary strand; from 2485380 to 2484100)