Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 236755
End position: 236781
Length: 27

DNA sequence
>NC_012669, from 236755 to 236781 (27 bp); Beutenbergia cavernae DSM 12333 TCGTGGCCCTCGTGGCCCTCGTGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 236713-237807	Sequence	Bcav_0221 - hypothetical protein (Protein is coded in complementary strand; from 237807 to 236713)