Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2310254
End position: 2310280
Length: 27

DNA sequence
>NC_012669, from 2310254 to 2310280 (27 bp); Beutenbergia cavernae DSM 12333 CGATCGCGGCGAGCGCGGCGAGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2309563-2310414	Sequence	Bcav_2028 - beta-lactamase (Protein is coded in complementary strand; from 2310414 to 2309563)