Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2281009
End position: 2281053
Length: 45

DNA sequence
>NC_012669, from 2281009 to 2281053 (45 bp); Beutenbergia cavernae DSM 12333 GGCCTCGGGCTCAGCGGCCTCGGGCTCAGCGGCCTCGGGCTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2279468-2281300	Sequence	Bcav_2001 - hypothetical protein (Protein is coded in complementary strand; from 2281300 to 2279468)