Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2252218
End position: 2252241
Length: 24

DNA sequence
>NC_012669, from 2252218 to 2252241 (24 bp); Beutenbergia cavernae DSM 12333 CGTCGCCGTCGACGACGCCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2250372-2252537	Sequence	Bcav_1973 - glycogen debranching protein GlgX (Protein is coded in complementary strand; from 2252537 to 2250372)