Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2176672
End position: 2176695
Length: 24

DNA sequence
>NC_012669, from 2176672 to 2176695 (24 bp); Beutenbergia cavernae DSM 12333 GTCGTCGGCGTCGGCGTCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2176457-2177545	Sequence	Bcav_1911 - polyprenyl synthetase (Protein is coded in complementary strand; from 2177545 to 2176457)