Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 2093655
End position: 2093679
Length: 25

DNA sequence
>NC_012669, from 2093655 to 2093679 (25 bp); Beutenbergia cavernae DSM 12333 CGCCGCGTCGCGCGGCTCCGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2093536-2094336	Sequence	Bcav_1834 - hypothetical protein (Protein is coded in complementary strand; from 2094336 to 2093536)