Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1889432
End position: 1889455
Length: 24

DNA sequence
>NC_012669, from 1889432 to 1889455 (24 bp); Beutenbergia cavernae DSM 12333 CCGGACCCAGACCCGGATCCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1889009-1889755	Sequence	Bcav_1644 - integral membrane protein (Protein is coded in complementary strand; from 1889755 to 1889009)