Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 188379
End position: 188414
Length: 36

DNA sequence
>NC_012669, from 188379 to 188414 (36 bp); Beutenbergia cavernae DSM 12333 GGCGATCTTCGCGGCGATCGTCGCGACGATGTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 187994-188893	Sequence	Bcav_0180 - binding-protein-dependent transport system inner membrane protein