Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1859525
End position: 1859548
Length: 24

DNA sequence
>NC_012669, from 1859525 to 1859548 (24 bp); Beutenbergia cavernae DSM 12333 GCGCTCGCGATCGCGATCGCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1859270-1860307	Sequence	Bcav_1616 - cytochrome d ubiquinol oxidase, subunit II (Protein is coded in complementary strand; from 1860307 to 1859270)