Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1789581
End position: 1789604
Length: 24

DNA sequence
>NC_012669, from 1789581 to 1789604 (24 bp); Beutenbergia cavernae DSM 12333 CGAGGACGAGCAGGAGGACGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1787897-1791169	Sequence	Bcav_1558 - hypothetical protein (Protein is coded in complementary strand; from 1791169 to 1787897)