Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1779603
End position: 1779629
Length: 27

DNA sequence
>NC_012669, from 1779603 to 1779629 (27 bp); Beutenbergia cavernae DSM 12333 CAGGTCGGCCAGGTCGGCCAGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1778812-1779696	Sequence	Bcav_1550 - inositol-phosphate phosphatase (Protein is coded in complementary strand; from 1779696 to 1778812)