Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1736113
End position: 1736136
Length: 24

DNA sequence
>NC_012669, from 1736113 to 1736136 (24 bp); Beutenbergia cavernae DSM 12333 GACGTCGACGGCGACGACGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1735016-1736350	Sequence	Bcav_1514 - sugar ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 1736350 to 1735016)