Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1643971
End position: 1643994
Length: 24

DNA sequence
>NC_012669, from 1643971 to 1643994 (24 bp); Beutenbergia cavernae DSM 12333 GGGCCGGGACCGGGGCCCGGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1643287-1644342	Sequence	Bcav_1442 - hypothetical protein (Protein is coded in complementary strand; from 1644342 to 1643287)