Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1597054
End position: 1597078
Length: 25

DNA sequence
>NC_012669, from 1597054 to 1597078 (25 bp); Beutenbergia cavernae DSM 12333 GCGTCGCGACGCGACGCGCCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1596501-1598093	Sequence	Bcav_1402 - glycoside hydrolase family 3 (Protein is coded in complementary strand; from 1598093 to 1596501)