Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1567093
End position: 1567116
Length: 24

DNA sequence
>NC_012669, from 1567093 to 1567116 (24 bp); Beutenbergia cavernae DSM 12333 GCGACGGCGGCGGGGACGGCGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1566829-1567377	Sequence	Bcav_1371 - hypothetical protein (Protein is coded in complementary strand; from 1567377 to 1566829)