Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 154663
End position: 154686
Length: 24

DNA sequence
>NC_012669, from 154663 to 154686 (24 bp); Beutenbergia cavernae DSM 12333 GGTCCGGGCCCGGCTCCGGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 154623-156869	Sequence	Bcav_0148 - HNH endonuclease (Protein is coded in complementary strand; from 156869 to 154623)