Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 144956
End position: 144991
Length: 36

DNA sequence
>NC_012669, from 144956 to 144991 (36 bp); Beutenbergia cavernae DSM 12333 GCCGCGAGCGTCACCGCGAGCGCCGCCGCGAGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 143684-145045	Sequence	Bcav_0137 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 145045 to 143684)