Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1433048
End position: 1433072
Length: 25

DNA sequence
>NC_012669, from 1433048 to 1433072 (25 bp); Beutenbergia cavernae DSM 12333 CGCGCAGCGCCGAGCCGCGTCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1432259-1433083	Sequence	Bcav_1261 - histidinol-phosphate phosphatase (Protein is coded in complementary strand; from 1433083 to 1432259)