Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1330645
End position: 1330668
Length: 24

DNA sequence
>NC_012669, from 1330645 to 1330668 (24 bp); Beutenbergia cavernae DSM 12333 GGCCGTGGCCGTAGCCGTGGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1328775-1330751	Sequence	Bcav_1179 - SpoIID/LytB domain-containing protein (Protein is coded in complementary strand; from 1330751 to 1328775)