Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1200150
End position: 1200173
Length: 24

DNA sequence
>NC_012669, from 1200150 to 1200173 (24 bp); Beutenbergia cavernae DSM 12333 TCGCGACCGCGAGCGCGATCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1199360-1200658	Sequence	Bcav_1059 - major facilitator superfamily protein (Protein is coded in complementary strand; from 1200658 to 1199360)