Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1186045
End position: 1186098
Length: 54

DNA sequence
>NC_012669, from 1186045 to 1186098 (54 bp); Beutenbergia cavernae DSM 12333 GCGTGGCCCGCGTGGCCCTCGTGTCCTGCGTGGCCCGCGTGGCCGCCGTGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1184014-1186251	Sequence	Bcav_1043 - copper-translocating P-type ATPase (Protein is coded in complementary strand; from 1186251 to 1184014)