Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1136810
End position: 1136863
Length: 54

DNA sequence
>NC_012669, from 1136810 to 1136863 (54 bp); Beutenbergia cavernae DSM 12333 GCGCCCGAGCCGACCCCGACACCCGAGCCGACCCCGACGCCGAAGCCGACCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1135659-1137791	Sequence	Bcav_1000 - Parallel beta-helix repeat-containing protein