Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1122201
End position: 1122230
Length: 30

DNA sequence
>NC_012669, from 1122201 to 1122230 (30 bp); Beutenbergia cavernae DSM 12333 TCCGCGGCGGTCAGCGGCCGGCCGCGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1121700-1122275	Sequence	Bcav_0988 - hypothetical protein (Protein is coded in complementary strand; from 1122275 to 1121700)