Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1035807
End position: 1035831
Length: 25

DNA sequence
>NC_012669, from 1035807 to 1035831 (25 bp); Beutenbergia cavernae DSM 12333 GCGGCGCGGTCCGGCGCGGCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1035776-1036975	Sequence	Bcav_0923 - FAD-dependent pyridine nucleotide-disulfide oxidoreductase (Protein is coded in complementary strand; from 1036975 to 1035776)