Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 1020474
End position: 1020497
Length: 24

DNA sequence
>NC_012669, from 1020474 to 1020497 (24 bp); Beutenbergia cavernae DSM 12333 GCGACGTCGACGTCGACGGAGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1020364-1021215	Sequence	Bcav_0912 - binding-protein-dependent transport system inner membrane protein