Sequence retrieval

Genome: Beutenbergia cavernae DSM 12333
Start position: 559532
End position: 559567
Length: 36

DNA sequence
>NC_012669, from 559532 to 559567 (36 bp); Beutenbergia cavernae DSM 12333 GCCTCCAGCTCCGCCTCCAGCTCCGCCTCCAGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 558875-560101	Sequence	Bcav_0504 - restriction modification system DNA specificity domain-containing protein (Protein is coded in complementary strand; from 560101 to 558875)