Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 682634
End position: 682657
Length: 24

DNA sequence
>NC_012632, from 682634 to 682657 (24 bp); Sulfolobus islandicus M.16.27 CCTAGCCCTATCCCTAGTCCTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 682311-683393	Sequence	M1627_0713 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 683393 to 682311)