Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 352749
End position: 352778
Length: 30

DNA sequence
>NC_012632, from 352749 to 352778 (30 bp); Sulfolobus islandicus M.16.27 TAATATTATATAATATAATATGATATATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 352777-353019	Sequence	M1627_0401 - hypothetical protein (Protein is coded in complementary strand; from 353019 to 352777)