Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 2663959
End position: 2663982
Length: 24

DNA sequence
>NC_012632, from 2663959 to 2663982 (24 bp); Sulfolobus islandicus M.16.27 TAAAAGTAAAAGTAAACGAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2663827-2666178	Sequence	M1627_2822 - Peptidase M1 membrane alanine aminopeptidase