Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 2248900
End position: 2248923
Length: 24

DNA sequence
>NC_012632, from 2248900 to 2248923 (24 bp); Sulfolobus islandicus M.16.27 GTAGTAGTAGTTGTGGTAGTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2248732-2250852	Sequence	M1627_2405 - family 5 extracellular solute-binding protein (Protein is coded in complementary strand; from 2250852 to 2248732)