Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 1957965
End position: 1957994
Length: 30

DNA sequence
>NC_012632, from 1957965 to 1957994 (30 bp); Sulfolobus islandicus M.16.27 AAAGAAATTAAATGGAATTATAAGAAATTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1957211-1958002	Sequence	M1627_2099 - competence damage-inducible protein A
ORF... 1957983-1958753	Sequence	M1627_2100 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 1958753 to 1957983)