Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 1925198
End position: 1925227
Length: 30

DNA sequence
>NC_012632, from 1925198 to 1925227 (30 bp); Sulfolobus islandicus M.16.27 CTTAAATCTTCTTCAGTCTTCTTTAACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1925171-1925800	Sequence	M1627_2065 - 6-phospho 3-hexuloisomerase (Protein is coded in complementary strand; from 1925800 to 1925171)