Sequence retrieval

Genome: Sulfolobus islandicus M.16.27
Start position: 102135
End position: 102158
Length: 24

DNA sequence
>NC_012632, from 102135 to 102158 (24 bp); Sulfolobus islandicus M.16.27 TTTTACCATTTTTCCATTTGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 102064-103098	Sequence	M1627_0115 - radical SAM protein (Protein is coded in complementary strand; from 103098 to 102064)