Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 425391
End position: 425426
Length: 36

DNA sequence
>NC_012623, from 425391 to 425426 (36 bp); Sulfolobus islandicus Y.N.15.51 GTTGTTGTAGTAGTTGTTGATGTACTTGTGGTAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 425175-427337	Sequence	YN1551_0459 - family 5 extracellular solute-binding protein (Protein is coded in complementary strand; from 427337 to 425175)