Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 1729727
End position: 1729756
Length: 30

DNA sequence
>NC_012623, from 1729727 to 1729756 (30 bp); Sulfolobus islandicus Y.N.15.51 TACCATTTCTTACCCATTCTTACCCTTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1729679-1730170	Sequence	YN1551_1960 - DNA polymerase beta domain-containing protein region (Protein is coded in complementary strand; from 1730170 to 1729679)