Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 1431123
End position: 1431152
Length: 30

DNA sequence
>NC_012623, from 1431123 to 1431152 (30 bp); Sulfolobus islandicus Y.N.15.51 TAATAGGAATAGTAGTAGCAATAGTAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1431060-1432493	Sequence	YN1551_1637 - extracellular solute-binding protein