Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 1390464
End position: 1390493
Length: 30

DNA sequence
>NC_012623, from 1390464 to 1390493 (30 bp); Sulfolobus islandicus Y.N.15.51 TAAGGCATATTAAGCAATATTAAGAGATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1389966-1390472	Sequence	YN1551_1598 - hypothetical protein (Protein is coded in complementary strand; from 1390472 to 1389966)