Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 849764
End position: 849790
Length: 27

DNA sequence
>NC_012623, from 849764 to 849790 (27 bp); Sulfolobus islandicus Y.N.15.51 CATTATTTCCAATATTTCCATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 848805-850211	Sequence	YN1551_0945 - adenylosuccinate lyase (Protein is coded in complementary strand; from 850211 to 848805)