Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 2783725
End position: 2783748
Length: 24

DNA sequence
>NC_012623, from 2783725 to 2783748 (24 bp); Sulfolobus islandicus Y.N.15.51 TAAAAGTAAAAGTAAACGAAAAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2783593-2785944	Sequence	YN1551_3140 - peptidase M1 membrane alanine aminopeptidase