Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 1671976
End position: 1671999
Length: 24

DNA sequence
>NC_012623, from 1671976 to 1671999 (24 bp); Sulfolobus islandicus Y.N.15.51 CCTAGCCCTATCCCTAGTCCTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1671653-1672735	Sequence	YN1551_1885 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 1672735 to 1671653)