Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 132575
End position: 132598
Length: 24

DNA sequence
>NC_012623, from 132575 to 132598 (24 bp); Sulfolobus islandicus Y.N.15.51 ATTAATATTAATATTGATATTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 132432-133781	Sequence	YN1551_0152 - AAA ATPase (Protein is coded in complementary strand; from 133781 to 132432)