Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 114328
End position: 114351
Length: 24

DNA sequence
>NC_012623, from 114328 to 114351 (24 bp); Sulfolobus islandicus Y.N.15.51 AGTTAATTAATTAATTAGGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 114343-115011	Sequence	YN1551_0133 - uracil-DNA glycosylase (Protein is coded in complementary strand; from 115011 to 114343)