Sequence retrieval

Genome: Sulfolobus islandicus Y.N.15.51
Start position: 1102263
End position: 1102286
Length: 24

DNA sequence
>NC_012623, from 1102263 to 1102286 (24 bp); Sulfolobus islandicus Y.N.15.51 AATTATAATTATACTTATTATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1101502-1102320	Sequence	YN1551_1243 - hypothetical protein (Protein is coded in complementary strand; from 1102320 to 1101502)