Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2520053
End position: 2520106
Length: 54

DNA sequence
>NC_012590, from 2520053 to 2520106 (54 bp); Corynebacterium aurimucosum ATCC 700975 GGTTCCTCGGCGAGCGCGGGTTCCTCGGCGAGCGCGGGTTCCTCGGCGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2519021-2520268	Sequence	cauri_2308 - hypothetical protein (Protein is coded in complementary strand; from 2520268 to 2519021)