Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1941691
End position: 1941738
Length: 48

DNA sequence
>NC_012590, from 1941691 to 1941738 (48 bp); Corynebacterium aurimucosum ATCC 700975 CGGAGCGGGAGCTGGTGCGGGAGCCGGAGCAGGTGCCGGAGCAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1941515-1942162	Sequence	cauri_1756 - hypothetical protein (Protein is coded in complementary strand; from 1942162 to 1941515)