Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2403507
End position: 2403551
Length: 45

DNA sequence
>NC_012590, from 2403507 to 2403551 (45 bp); Corynebacterium aurimucosum ATCC 700975 GCATGACCATGGCGATCATGATCATGGAGAACATGAGCATGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2403098-2404165	Sequence	cauri_2206 - ABC transporter, solute-binding protein