Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 1800863
End position: 1800907
Length: 45

DNA sequence
>NC_012590, from 1800863 to 1800907 (45 bp); Corynebacterium aurimucosum ATCC 700975 CTTCTTCTCCTCAGAAGTCTTCTCCTCAGACGTCTTTTCCTTAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1800315-1801082	Sequence	cauri_1628 - hypothetical protein (Protein is coded in complementary strand; from 1801082 to 1800315)