Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2587117
End position: 2587152
Length: 36

DNA sequence
>NC_012590, from 2587117 to 2587152 (36 bp); Corynebacterium aurimucosum ATCC 700975 CCTCATCGTCGGGCTCATCCTCGGCCTCTTTGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2587065-2589518	Sequence	cauri_2362 mmpL1 drug exporter of the RND superfamily