Sequence retrieval

Genome: Corynebacterium aurimucosum ATCC 700975
Start position: 2437403
End position: 2437438
Length: 36

DNA sequence
>NC_012590, from 2437403 to 2437438 (36 bp); Corynebacterium aurimucosum ATCC 700975 GCGCCTTCGGCTGCGGCTTCGACTGGGCCTTTGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2437147-2438460	Sequence	cauri_2238 - Zinc metalloprotease (Protein is coded in complementary strand; from 2438460 to 2437147)